Rice (Oryza sativa L.) is a model plant of cereal species, as well as one of the most important food crops in the world. In rice breeding, pollen grains fertility is crucial for its generation transmission and crop production. Three-line and two-line hybrid rice are the successful application of pollen development characteristics. From sporogenous cells to mature pollen, male gametophyte development involves a large number of genes which are coordinate expression and regulation in sporophyte and gametophyte cells. Comparing with the female gametophyte development, male gametes (pollen) development which do not have obstruction of the ovary wall can be more easily used to study the processes of rice growth and development of the important biological problems in rice, such as cell polarity, division, differentiation and signal transduction (McCormick, 1993; McCormick, 2004).

In recent years, rice pollen development related genes research have made some progress. Based on certain research tools, such as mutant identification, gene expression differences analysis and comparative genomics, a number of pollen development related genes associated with each process in rice were identified and cloned. For example, MSP1 gene expressed in surrounding cells of male and female sporocytes and some flower tissues, controlling the primary wall cells and primary sporogenous cell development in rice (Nonomura et al., 2003); OsRad21-4 continuously expressed from before microspore mother cells meiosis to meiosis stages, participating in meiosis homologous chromosomes pairing and sisters chromosome synapsis (Zhang et al., 2006); PAIR1and PAIR2 gene expressed mainly at the microspore mother cells meiotic stages and played an essential role in establishment of homologous chromosome pairing in rice meiosis (Nonomura et al., 2004a; Nonomura et al., 2004b); OsPBP1 protein was a novel functional C2-domain phospholipids-binding protein and localized in a region peripheral to pollen wall and vesicles of elongating pollen tube (Yang et al., 2008); RA68 expressed persistently from the pollen mother cell differentiation to mononuclear microspore stages and might be required for postmeiotic pollen development by affecting pollen mitosis I and starch accumulation (Li et al., 2008); RIP1 was most active at the late binucleate microspore and trinucleate microspore stages, which probably carried out an important role during the late stage of pollen formation (Han et al., 2006); Osnop gene expressed only in late stage of pollen development with the highest expression at the stage of pollen release and germination, and then probably cross-linked both calcium and phosphoinositide signaling pathways (Jiang et al., 2005); AID1controled the normal maturation pollen grains and anther dehiscence, as well as increased tillering and early flowering (Zhu et al., 2004); however, comparing with a great deal of genes in the pollen development process (Hobo et al., 2008; Suwabe et al., 2008), pollen development molecular mechanisms are still at an exploratory stage. Thus deep investigation in this area will present practical and theoretical significance.

During several years studies of transgenic rice, we found that some transgenic successive generations couldn’t be homozygous. And then through tracking exogenous marker gene hygromycin B phosphotransferase (Hygromycin-B-phosphotransferase, hpt) gene, some transgenic mutants showed a 1:1 separation ratio. This study selected one of these mutants (tentatively named Male gametophyte abortion1, mga1 (t)) to do the genetic analysis and pollen cells observation, and then founded that it was a male gametophyte abortion mutant caused by T-DNA insertion. At the same time, Tail-PCR and RT-PCR expression analysis methods were used to determine T-DNA insertion site. The results showed the insertion site was located in the 5 'untranslated region of a Bax inhibitor (BI) -1 like family protein gene and MGA1(t) expressed preferentially in male gametophytic development stage.  

1 Results and Analysis

1.1 Genetic analysis of mga1(t) mutant and pollen cytological observation

There were no significant differences between mga1(t) mutant and wild type Minghui-86 during nutrition reproductive stage. In order to analyze genetic transmission law of mga1(t) mutant, marker gene (hpt) of transgenic rice was molecular detected by using PCR and leaves immersion test. The results found that the offspring of mga1 (t) mutant cannot be homozygous all the time, which kept heterozygosis for all generations. The line showed a 1:1 ratio of hpt⁺: hpt^- plants (acceptable χ² value) after selfing (279:320), which pointed out that mga1(t) transfer might cause gametophytic abortion mutant.

The 1:1 hpt⁺: hpt^- segregation (122:123) was also observed on all descendants using the mga1 (t) mutant as female parent, hybridization with Minghui-86, according to a χ² test (P= 0.05); while the progeny showed sensitivity to hygromycin using the mga1 (t) mutant as male parent (Table 1). These indicated that hpt gene could only be delivered through female gametes, not male gametes and transgenosis caused pollen abortion. Selfed seed set of mga1 (t) mutant was normal in maturity stage, where the test-cross descendants were sensitive to hygromycin, which demonstrated that some non-transgenic pollen existed in the mutant. Thus, we presumed that gametophyte abortion was caused by transgenosis but not sporophyte abortion.

In order to determine the copy number of T-DNA in mga1 (t) line, we chose the gene hpt fragment as the probe and the single cutting enzymes Kpn I, Sac I, Sph I and Hind III to digest the genomic DNA. Southern blot analysis results showed that a single band was obtained in all these enzymes, which demonstrated the mutant mga1(t)contained a single copy of the T-DNA (Figure 1).

The pollen fertility and morphology were observed further by iodine staining and scanning electron microscope, Under optical microscope, we found the rate of fertile pollen grains of mga1(t) mutants was (50.07±2.67)%, as well as that of stained abortive pollen grains was (49.94±2.67)%; while that of the fertile pollen grains of Minghui-86 was (98.0 ± 1.48)% (Figure 2). (49.48 ± 2.1)1% round pollen grains and (50.52 ± 2.11)% shrinking pollen grains were found under the scanning electron microscope, respectively; while 97.9±2.01% round pollen grains and rarely shrinking pollen grains were found in Minghui-86. The results further indicated that mga1 (t) mutant was a male gamete (pollen) abortion mutant.

Taken together, we preliminary considered that the mga1 (t) mutant was a male gamete sterile mutant, exogenous marker gene hpt and its mutant character was co-segregated.

1.2 Identification of the T-DNA insertion site and sequence analysis of the T-DNA–tagged gene

The flanking regions of the inserted T-DNA were amplified in mga1 (t) line by Tail-PCR using the genomic DNA as a template (Figure 3A), and then the amplified fragments were recovered and sequenced. Sequence analysis of the region by NCBI database BLASTN revealed that the T-DNA inserted into rice genome on chromosome 3 AC092076 BAC clone (Figure 3B). To validate the insertion site, we used the primer which was designed based on the flanking regions of the inserted sequence and Tnos3 to PCR amplification of mutant DNA. The result showed its amplification fragment which was uniform with the predicted size was 680 bp (Figure 4), which further verified that the locus was the T-DNA insertion locus.

After analysis the annotation information by NCBI database, we found that T-DNA was inserted at the 5 'untranslated region of the unknown function of UPF0005 protein gene family on rice chromosome 3, 198 bp upstream from the initiation codon ATG. The unknown protein gene was 2 358 bp, containing 4 exons and 3 introns, and the length of its CDS was 726 bp, encoding 241 amino acids. Amino acid sequence analysis showed that its protein sequence belonged to Bax inhibitor (BI) - 1 like protein family. BI-1 like proteins were a highly conservative and small transmembrane type proteins, most positioning in the endoplasmic reticulum. BI-1 like proteins in some mammalian had an inhibition effect of programmed cell death and BAX-dependent developmental cell death. We preliminary selected it as the candidate gene of the mga1 (t) mutant, temporarily named Male Gametophyte Abortion1, MGA1 (t) gene.

The upstream 1257 bp sequence of the candidate MGA1 (t) gene was analyzed by plant cis-element analysis software, the results found that the sequence contained most of higher plants' conservative promoter basic elements such as TATA box and CAAT box, etc.; many components related to sunlight, temperature, hormones synthesis and decomposition, such as ABRE, CGTCA-motif, TGACG-motif DPBFCOREDCDC3 and CGTCA-motif, etc.. In addition, it contained 4 sections related to the α-amylase synthesis and degradation, "POLASIG1", "POLASIG2", "PYRIMIDINEBOXOSRAMY1A" and "WBBOXPCWRKY1" sites. α-amylase enzyme to Ca^{2 +} as the essential factor and stability factor, acting on starch, cutting α-1, 4 - chain reaction caused the disappearance of iodine. These predictions results indicated that the sequence might be the MGA1 (t) mutant promoter sequence.

1.3 The mutant phenotype co-segregated with T-DNA insertion

In order to get corresponding relationship between mga1 (t) mutant phenotype and the T-DNA, we used a / c and b/Tnos3 two primer combinations (Figure 5) to analyze 96 plants in mga1 (t) mutant line. According to transgenic vector size, we speculated the fragment which was about 11 kb in the mutant genomic T-DNA. Therefore, when a single plant showed three conditions using a / c and b/Tnos3 primers to amply: a/c with a target band, and b/Tnos3 no target band, the individual was wild type; a / c and b/Tnos3 both with target bands, which was heterozygous type; a / c with no target band, and b/Tnos3 targeted band, the plant individual was homozygous type. Based on the above mentioned, the progeny genotype groups of mga1 (t) mutant line were showed in table 2, there were 45 wild-type individuals and 51 heterozygous individuals. We didn’t detect homozygous individuals, so the mga1 (t) mutant could only exist heterozygous form.

And then, the different genotypes of the above plants were detected hpt gene expression and pollen cytology (Table 2), the results showed 51 heterozygous plant were hygromycin resistant plants and pollen fertility were semi-sterility; 45 wild-type plants were hygromycin sensitivity plants and pollen fertility were normal (data not provided). These further proved the semi-sterility pollen phenotype co-segregated with the locus of T-DNA insertion in the mga1 (t) mutant, the T-DNA insertion led to mutant male gametes (pollen) abortion phenotype.

1.4 Expression analysis of candidate MGA1(t) gene

Using RT-PCR technique, candidate MGA1 (t) gene expression modes were analyzed in different tissues during seedling, tillering, heading and filling stages and florets forming each period in wild-type Minghui 86, the results showed that all testing organs could detect MGA1 (t) gene, but it had strong expression in 0~7 mm florets (Figure 6). Comprehensive genetic analysis and pollen cytological observation of mga1 (t) mutant, MGA1(t) gene was a male-preferential expressed gene in rice.

2 Discussion

Male gametophyte development was one of the most important processes in angiosperms reproductive development. From sporogenous cells to mature male gametes (pollen), male gametophyte development involved about 20 000 genes expression (Vizir et al., 1994; Borg et al., 2009), and cloning and analysis important genes function in pollen development process had become a hot spot study on angiosperms development and growth. So far, pollen sterility mutants reported in rice were generally divided into two types: sporophyte abortion and gametophyte abortion. Sporophyte abortion mutant was determined by sporophyte (somatopiasm) genotype,  usually had nothing to do with its gametophyte genotype, and then all pollen display infertility and mutant phenotype was found and identified more easily. So sporophyte abortion mutants and their role genes had been investigated more. In the formation of spore mother cells and tapetum stages, such as MSP1 (Nonomura et al.,2003), udt1 (Jung et al., 2005), wda1 (Jung et al.,2006) and tdr (Li et al., 2006; Zhang et al., 2008), and during microspore mother cells meiotic stage, for example,  PAIR1(Nonomura et al., 2004a), PAIR2 (Nonomura et al., 2004b), OsRad21-4 (Zhang et al., 2006), OsRad21-3 (Tao et al., 2007) and PAIR3 (Yuan et al., 2009), which all played an important role. However, gametophyte abortion mutant was determined by gametophyte genotype. These mutants generally couldn`t be homozygous and showed heterozygous state, but almost not affected seed set, which caused that they were hard to be found and screened in usual conditions. Therefore, gametophyte abortion mutants and their related genes rarely had been reported.

At present, people had developed some new strategies screening male gamete mutants, a strategy was to use histochemical staining method. The strategy had been successfully applied in Arabidopsis. For example, using DAPI staining, Chen et al selected sidecar pollen mutants (Chen and McCormick, 1996) and Park et al. screened gemini pollen mutant (Park et al., 1998); Using aniline blue staining, Johnson et al obtained raring-to-go, gift-wrapped pollen, polka dot pollen, emotionally fragile pollen and other male gamete abortion mutants (Johnson and McCormick, 2001). Another strategy was used in transgenic capture system of reporter gene expression to screen male gametes abortion mutants. Utilizing GUS gene as reporter gene promote, Jeon et al  captured seven rice male gametes abortion mutants whose GUS expressed during the latter of pollen vacuolization stage, including rip1 mutant (Jeong et al. 2002). However, due to the huge amount of pollen samples, pollen fertility and stability was easily affected by environmental condition, to a certain extent so as to limit the above two kinds of strategy use. Another screening strategy was based on transgenosis insert elements′abnormal genetical separation (1:1). By screening the abnormal segregation ratio of exogenous marker gene, we selected gametophyte sterility mutant, which could avoid the direct observation of gametophyte development process to ensure the accuracy of the results. At the same time, gametophytic development related genes selected through this strategy were generally the key genes, or the separation ratio of their offspring could not be presented partial segregation rules. At the moment, through marker genes abnormal separation (1:1), seven male gamete abortion mutants had been successfully selected in Arabidopsis (Feldmann et al., 1997; Howden et al., 1998; Bonhomme et al., 1998). Meanwhile, we used a similar strategy to select 38 rice male gamete sterile mutants by screening marker gene (hpt) abnormal separation (1:1) in transgenic rice breeding. In this study, mga1 (t) was one of the new gametophyte genotype determined pollen abortion mutants, genetic and candidate gene analysis revealed this mutant was different from the reported pollen sterile mutants in rice.

T-DNA flanking sequence analysis in mga1(t) mutant showed the T-DNA inserted into 5 'untranslated region of a Bax inhibitor (BI) -1 like protein gene on chromosome 3. Gene expression analysis revealed this gene had an advantage expression characteristic in anther, showed the BI-1 like gene might be the candidate gene of mga1 (t) mutant. MGA1 (t) protein contained seven transmembrane domains, which were in agreement to the Bax inhibitor-1 protein structure characteristics. Bax inhibitor-1 was a relatively conservative cell death inhibitory factor, affected by reactive oxygen species, calcium ion concentration and mitochondrial degradation factors, and existed widely in plants and animals (Huckelhoven, 2004). BI-1 over-expression had closely related to tumorigenesis and metastasis in animals (Zhang and Zhou, 2007). In plants, BI-1 gene regulated programmed cell death induced by endoplasmic reticulum stress, and this regulatory process was related to protein folding, reactive oxygen species accumulation and heme oxygenase in endoplasmic network (Lee et al., 2007; Watanabe and Lam, 2008).

Programmed cell death accompanied by the whole growth and development in plant. From embryonic development to roots, stems, leaves, flowers, fruits, seeds and other organs formation development, cells continued constantly to proliferation and differentiation, meanwhile with programmed cell death phenomenon. Numerous studies had shown that plant male gametes (pollen) development process was closely related to the programmed cell death. After microspore form, tapetum programmed death was necessary to microspore develop into mature pollen grains. The expression of AtBI-1 gene inhibited tapetum cell degradation after the tetrad stage of microspore development in Arabidopsis, eventually leading to its tapetum not normally enter programmed cell death pathways, pollen abortion (Kawanabe et al., 2006). Based on genetic, pollen morphology and RT-PCR analysis, BI-1 like gene, MGA1 (t) control mechanism was clearly different from AtBI-1 gene and others reported pollen sterility genes. Also MGA1 (t) gene regulated pollen fertility in the later pollen development stages, should be in meiosis after pollen grains completion formation process. But rice pollen development in these stages involving how programmed cell death and regulation mechanism was still lack of research, so further study on MGA1 (t) gene would undoubtedly contribute to our understanding regulated mechanisms during these stages.

3 Materials and Methods

3.1 Plant materials

Transgenic mutant mga1 (t) was produced by Agrobacterium (strain LBA4404)-mediated infecting Minghui-86 in Fujian Province Key Laboratory of Agricultural Genetic Engineering, Fujian Academy of Agricultural Sciences. CUBACloxHpt vector containing a T-DNA which carrying hpt gene, cryIA (c) gene and sck gene, respectively under control of mas, Ubiquitin and Actin promoter was used to transformation.

The mutant mga1 (t), corresponding to wild-type Minghui 86, and three-line infertility II-32A are all reserved by our laboratory in this research, and planted in Wu Feng experiment site, Fuzhou province.

3.2 Genetic analysis of exogenous marker gene hpt in mga1(t) mutant

At flowering stage, mga1(t) served as the pollen donor were tested cross with II-32A, as well as  mga1(t) served as the female parent were hybridized with Minghui-86. Subsequently, the progeny of test-cross and cross-breeding were planted to the molecular testing and expression detection of hpt gene. Through above ways, the transmission pattern of marker gene hpt was analyzed.

PCR amplification of hpt gene in rice genome: total genomic DNA was extracted from leaf samples of individual plant in tillering exuberant stage following the method described by CTAB method (Murra and Wang, 1980). PCR analysis was carried on using primers specific for the hpt gene (forward TACACAGCCATCGGTCCAGA; reverse: TAGGAGGGCGTGGATATGTC), which amplification product fragment was 844 bp. PCR was performed with an initial 5 min denaturation at 94°C, followed by 35 cycles (each cycle: 94°C, 1 min; 56°C, 1 min; and 72°C, 1 min), then a final 8 min at 72°C. Then the 5 μL PCR products were distinguished by electrophoresis using 1% agarose gel.

Leaf sensitivity test of hpt gene expression: leaf samples of individual plant collected from tillering exuberant stage were taken and intercepted the middle of about 15 cm fragment. Then the leaves (the base is about 3 ~ 5 cm) were soaked in 50 µg ml-1 hygromycin B (Roche Diagnostics (Shanghai) Ltd., Shanghai, China) aqueous solution and sealed in an illuminated growth chamber at 27 °C. After 3 ~ 5 days, leaves sensitive to hpt gene expression were observed. The hygromycin resistant leaves maintained fresh green but hygromycin sensitive leaves gradually appeared brown spots. Then the phenotype (resistant and sensitive) of Leaf sensitivity test of hpt gene expression was scored by Chi-square statistics (α=0.05) in the mutant line.

3.3 Southern bolt analysis

Genomic DNA was extracted from young leaves of the mga1(t) mutant by the CTAB method and  digested with each restriction enzyme (Kpn I, Hind III, Sph I and Sac I). After blotting, the pre-hybridization, hybridization and washing the membrane, hybridization signals were visualized on autoradiography film using an alkaline phosphatase conjugate in the presence of chemiluminescent substrate CDP-Star. Hybridization with the Gene Images AlkPhos direct labeling and detection system (Amersham Pharmacia) were performed as described in the supplier’s protocol.

3.4 Cytological analysis of pollen

Pollen fertility examination: Five individual mga1(t) mutant and Minghui-86 were randomly selected before pollen dehiscence. Three florets per panicle were taken from the upper and middle portions of the panicle and stained with with 1% (w/v) I₂-KI, and observed under a light microscope (×100). Pollen fertility was divided into four types, typical abortive pollen, spherical abortive pollen, stained abortive pollen and fertile pollen based on stain ability and pollen shape. Per floret was randomly observed on two field, and then the number of all types of pollen were recorded and the percentage of various types of pollen was statistics.

Scanning electron microscopic analyses pollen morphology: Ten mature anthers were randomly respectively selected from the Minghui-86 and mutant plants at the time of heading. And then samples were fixed in 2.5% glutaraldehyde for 4 h; 1% osmic acid for 4 h; washed for three times with 0.1 mol/l phosphate buffer (each 15min);dehydrated (each 15min) through an ethanol series (from 30% to 90%), and 100% ethanol dehydration twice (each 15min); replaced for twice with tertiary butyl alcohol (each 15min); then critical point dried in carbon dioxide (HCP-2), mounted on stubs, sputtered with palladium gold (BC-II ion sputtering instrument) and observed in an emission SEM (KYKY-1000B). The three perspectives of each sample were taken under the scanning electron microscope observation.

3.5 Isolation of T-DNA flanking sequence by TAIL-PCR

Applied the nested sequence-specific primers and the shorter arbitrary degenerate primers (AD1-AD10), mga1(t) mutant genomic DNA were carried out Tail-PCR which was conducted as described previously (Liu and Whittier, 1995). The specific primers were Tnos1 (5'-gATTgAATCCTgTTgCCggTCTTg-3'), Tnos2 (5'-TTCTgTTgAATTACgTTAAgCATgT-3') and Tnos3 (5'-gATgggTTTTTATgATTAgAgTCC-3'). The PCR products (second and third of the Tail-PCR) were run on 1.5% agarose gels. The third PCR product was subjected to recovery according to Universal DNA Purification Kit (Tiangen biotech, Beijing), then linked with PMD-18T vector (TAKARA ) for further sequence detecting by sanbo yuanzhi company. In order to verify T-DNA insert position, the primer (5'-AAACAAAAgAACAggAAgAAAAAT-3') based on insertional locus and Tnos3 were used to PCR amplification. The amplification product fragment was 680 bp.

3.6 Genotyping the mutant plants

The co-segregation relationship between the sterile phenotype and the T-DNA insertion was analyzed by PCR. The PCR genotyping for 96 individual mga1(t) plants was performed using four primers: a (5'-CgAAgACgAgACgACgACATAC-3'), b(5'-AAACAAAAgAAACAggAAgAAAAAT-3'), c ( 5'-CAACgCAACCACCAAgCAC-3) and Tnos3. The amplification product fragment of a + c pair primes was 430 bp, and b + Tnos3 pair primes was 680 bp.

3.7 Molecular information analysis of T-DNA flanking sequence insertional locus

A rice genomic sequence corresponding to the T-DNA flanking sequence was identified using BLASTN on the Institute of Genomic Research database (http://blast.ncbi.nlm.nih.gov/Blast.cgi).

The prediction of the mutant promoter and analysis of regional regulatory elements were carried on the following Web site: http://www.fruitfly.org/seq_tools/promoter.html；http://www.dna.affrc.go.jp/PLACE/signalscan.html；http://bioinformatics.psb.ugent.be/webtools/plantcare/html/

3.8 Expression analysis of candidate MGA1(t) gene

Total RNA was isolated using Trizol Reagent (Invitrogen) as described by the supplier from Minghui-86 organizations at seedling, tillering, heading and filling stages. The stages of floret were classified into the following categories according to floret length: < 3 mm florets, 3- 5 mm florets, 5~ 7 mm florets, 7~ 9 mm not heading florets, and 7~9 mm mature pollen stage florets. Reverse transcription was according to Promega A3500 reverse transcriptase kit (Promega). To β-actin gene as an internal, β-actinA: 5'-TCCATCTTggCATCTCTCAg-3', β-actinB: 5'-gTACCCgCATCAggCATCTg-3', the amplification product fragment was 335 bp. Primers for candidate MGA1(t) gene were 5'-CTTCCTgCCCCTCATCgTgT-3' and 5'-CgAgACAgCAgCCCA gACAT-3', the amplification product fragment was 430bp. PCR reaction system: 10×Buffer 2.5 μl, 5′Primer(5 μmol/L) 1 μl , 3′Primer (5 μmol/L) 1 μl , TaqE (TaKaRa) 0.4 μl, 1.5μl dNTPs (2.5 μmol/L, TaKaRa), 50 ng cDNA and ddH₂O added to 25 μl. The reaction included an initial 5 min denaturation at 94℃, followed by 25 cycles of PCR (94℃ for 1 min, 60℃ for 1 min and 72℃ for 45 sec), and a final 8 min at 72℃. Afterward, 5 ml of the reaction mixture was separated on a 1% agarose gel.

Authors’Contributions

RC and FW have finished the paper, QXL, FKY, SHY, HQL AND SFZ also read the manuscript and revised it. All authors read and approved the final manuscript.

Acknowledgments

This work was supported by Natural Science Foundation of China (Grant No.30470934) and Natural Science Foundation of Fujian, China (Grant No. B0610020; 2010J01098).

References

Bonhomme S., Horlow C., Vezon D., de Laissardière S., Guyon A., Férault M., Marchand M., Bechtold N., and Pelletier G., 1998, T-DNA mediated disruption of essential gametophytic genes in Arabidopsis is unexpectedly rare and cannot be inferred from segregation distortion alone, Mol. Gen. Genet., 260(5): 444-452
https://doi.org/10.1007/s004380050915
PMid:9894914

Borg M., Brownfield L., and Twell D., 2009, Male gametophyte development: a molecular perspective, J. Exp. Bot., 60(5): 1465-1478
https://doi.org/10.1093/jxb/ern355
PMid:19213812

Chen Y.C., and McCormick S., 1996, Sidecar pollen, an Arabidopsis thaliana male gametophytic mutant with aberrant cell divisions during pollen development, Development, 122(10): 3243¬-3253
https://doi.org/10.1242/dev.122.10.3243
PMid:8898236

Feldmann K.A., Coury D.A., and Christianson M.L., 1997, Exceptional segregation of a selectable marker (Kan^R) in Arabidopsis identifies genes important for gametophytic growth and development, Genetics, 147(3): 1411-1422
https://doi.org/10.1093/genetics/147.3.1411
PMid:9383081 PMCid:PMC1208262

Han M.J., Jung K.H., Yi G., Lee D.Y., and An G., 2006, Rice Immature Pollen 1 (RIP1) is a regulator of late pollen development, Plant Cell Physiol., 47(11): 1457-1472
https://doi.org/10.1093/pcp/pcl013
PMid:16990291

Hobo T., Suwabe K., Aya K., Suzuki G., Yano K., Ishimizu T., Fujita M., Kikuchi S., Hamada K., Miyano M., Fujioka T., Kaneko F., Kazama T., Mizuta Y., Takahashi H., Shiono K., Nakazono M., Tsutsumi N., Nagamura Y., Kurata N., Watanabe M., and Matsuoka M., 2008, Various spatiotemporal expression profiles of anther-expressed genes in rice, Plant cell physiol., 49(10): 1457-1472
https://doi.org/10.1093/pcp/pcl013
PMid:16990291

Howden R., Park S.K., Moore J.M., Orme J., Grossniklaus U., and Twell D., 1998, Selection of T-DNA-tagged male and female gametophytic mutants by segregation distortion in Arabidopsis, Genetics,149(2): 621-631
https://doi.org/10.1093/genetics/149.2.621
PMid:9611178 PMCid:PMC1460162

Huckelhoven R., 2004, BAX Inhibitor-1, an acient cell death suppressor in animals and plants with prokaryotic relatives, Apoptosis, 9(3): 299-307
https://doi.org/10.1023/B:APPT.0000025806.71000.1c
PMid:15258461

Jeong D.H., An S., Kang H.G., Moon S., Han J.J., Park S., Lee H.S., An K., and An G., 2002, T-DNA insertional mutagenesis for activation tagging in rice, Plant Physiol., 130(4): 1636-1644
https://doi.org/10.1104/pp.014357
PMid:12481047 PMCid:PMC166679

Jiang S.Y., Cai M., and Ramachandran S., 2005, The Oryza sativa no pollen (Osnop) gene plays a role in male gametophyte development and most likely encodes a C2-GRAM domain-containing protein, Plant Mol. Biol., 57(6): 835-853
https://doi.org/10.1007/s11103-005-2859-x
PMid:15952069

Johnson S.A., and McCormick S., 2001, Pollen germinates precociously in the anthers of raring-to-go, an Arabidopsis gametophytic mutant, Plant Physiol., 126(2): 685-695
https://doi.org/10.1104/pp.126.2.685
PMid:11402197 PMCid:PMC111159

Jung K.H., Han M.J., Lee D.Y., Lee Y.S., Schreiber L., Franke R., Faust A., Yephremov A., Saedler H., Kim Y.W., Hwang I., and An G., 2006, Wax-deficient anther1 is involved in cuticle and wax production in rice anther walls and is required for pollen development, The Plant Cell, 18(18): 3015-3032
https://doi.org/10.1105/tpc.106.042044
PMid:17138699 PMCid:PMC1693940

Jung K.H., Han M.J., Lee Y.S., Kim Y.W., Hwang I., Kim M.J., Kim Y.K., Nahm B.H., and An G., 2005, Rice undeveloped tapetum1 is a major regulator of early tapetum development, The Plant Cell, 17(10): 2705-2722
https://doi.org/10.1105/tpc.105.034090
PMid:16141453 PMCid:PMC1242267

Kawanabe T., Ariizumi T., Kawai-Yamada M., Uchimiya H., and Toriyama K., 2006, Abolition of the tapetum suicide program ruins microsporogenesis, Plant cell physiol., 47(6): 784-787
https://doi.org/10.1093/pcp/pcj039
PMid:16565524

Lee G.H., Kim H.K., Chae S.W., Kim D.S., Ha K.C., Cuddy M., Kress C., Reed J.C., Kim H.R., and Chae H.J., 2007, Bax Inhibitor-1 regulates endoplasmic reticulum stress-associated reactive oxygen species and heme oxygenase-1 expression, J. Biological chemistry, 282(30): 21618-21628
https://doi.org/10.1074/jbc.M700053200
PMid:17526500

Li N., Zhang D.S., Liu H.S., Yin C.S., Li X.X., Liang W.Q.,Yuan Z., Xu B., Chu H.W., Wang J., Wen T.Q., Huang H., Luo D., Ma H., and Zhang D.B., 2006, The rice tapetum degeneration retardation gene is required for tapetum degradation and anther development, The Plant Cell, 18(11): 2999-3014
https://doi.org/10.1105/tpc.106.044107
PMid:17138695 PMCid:PMC1693939

Li T., Gong C.Y., and Wang T., 2010, RA68 is required for postmeiotic polleln development in Oryza sativa, Plant Mol Bio., 72(3): 265-277
https://doi.org/10.1007/s11103-009-9566-y
PMid:19888555

Liu Y.G., and Whittier R.F., 1995, Thermal asymmetric interlaced PCR: automatable amplification and sequencing of insert end fragments from PI and YAC clones for chromosome walking, Genomic, 25(3):  674-681
https://doi.org/10.1016/0888-7543(95)80010-J

McCormick S., 1993, Male gametophyte development, The Plant Cell, 5(10): 1265-1275
https://doi.org/10.2307/3869779
PMid:12271026 PMCid:PMC160359

McCormick S., 2004, Control of male gametophyte development, The Plant Cell, 16(S): 1265-1275
https://doi.org/10.2307/3869779
PMid:12271026 PMCid:PMC160359

Murra Y.M.G., and Thompson W.F., 1980, Rapid isolation of high molecular weight plant DNA, Nucleic Acids Research, 8(19): 1265-1275
https://doi.org/10.2307/3869779
PMid:12271026 PMCid:PMC160359

Nonomura K.I., Miyoshi K., Eiguchi M., Suzuki T., Miyao A., Hirochika H., and Kurata N., 2003, The MSP1 gene is necessary to restrict the number of cells entering into male and female sporogenesis and to initiate anther wall formation in rice, The Plant Cell, 15(8): 1728-1739
https://doi.org/10.1105/tpc.012401
PMid:12897248 PMCid:PMC167165

Nonomura K.I., Nakano M., Fukuda T., Eiguchi M., Miyao A., Hirochika H., and Kurata N., 2004a, The novel gene HOMOLOGOUS PAIRING ABERRATION IN RICE MEIOSIS1 of rice encodes a putative coiled coil protein required for homologous chromosome pairing in meiosis, The Plant Cell, 16(4): 1008-1020
https://doi.org/10.1105/tpc.020701
PMid:15031413 PMCid:PMC412873

Nonomura K.I., Nakano M., Murata K., ,Eiguchi M., Miyao A., Hirochika H., and Kurata N.,2004b, An insertional mutation in the rice PAIR2 gene, the ortholog of Arabidopsis ASY1, results in a defect in homologous chromosome pairing during meiosis, Mol. Genet. Genomics, 271(2): 121-129
https://doi.org/10.1007/s00438-003-0934-z
PMid:14758540

Park S.K., Howden R., and Twell D., 1998, The Arabidopsis thaliana gametophytic mutation gemini pollen disrupts microspore polarity, division asymmetry and pollen cell fate, Development, 125(19): 121-129
https://doi.org/10.1007/s00438-003-0934-z
PMid:14758540

Suwabe K., Suzuki G., Takahashi H., Shiono K., Endo M., Yano K., Fujita M., Masuko H., Saito H., Fujioka T., Kaneko F., Kazama T., Mizuta Y., Kawagishi-Kobayashi M., Tsutsumi N., Kurata N., Nakazono M., and Watanabe M., 2008, Separated Transcriptomes of male gametophyte and tapetum in rice: Validity of a laser microdissection (LM) microarray, Plant cell physiol., 49(10): 1407-1416
https://doi.org/10.1093/pcp/pcn124
PMid:18755754 PMCid:PMC2566930

Tao J.Y., Zhang L.R., Chong K. and Wang T., 2007, OsRAD21-3, an orthologue of yeast RAD21, is required for pollen development in Oryza sativa, The Plant J., 51(5): 1407-1416
https://doi.org/10.1093/pcp/pcn124
PMid:18755754 PMCid:PMC2566930

Vizir I.Y., Anderson M.L., Wilson Z.A., and Mulligan B.J., 1994, Isolation of deficiencies in the Arabidopsis genome by γ- irradiation of pollen, Genetics, 137(4): 1111-1119
https://doi.org/10.1093/genetics/137.4.1111
PMid:7982565 PMCid:PMC1206058

Watanabe N., and Lam Eric., 2008, Bax Inhibitor-1 modulate endoplasmic reticulm stress-mediated programmed cell death in Arabidopsis, J. Biological Chemistry, 283(6): 1111-1119
https://doi.org/10.1093/genetics/137.4.1111
PMid:7982565 PMCid:PMC1206058

Yang W.Q., Lai Y., Li M.N., Xu W., and Xue Y.B., 2008, A novel C2-domain phospholipid-binding protein, OsPBP1, is required for pollen fertility in rice, Molecular Plant, 1(5): 1111-1119
https://doi.org/10.1093/genetics/137.4.1111
PMid:7982565 PMCid:PMC1206058

Yuan W.Y., Li X.W., Chang Y.X., Wen R.Y., Chen G.X., Zhang Q.F. and Wu C.Y., 2009, Mutation of the rice gene PAIR3 results in lack of bivalent formation in meiosis, The Plant J., 59: 303-315
https://doi.org/10.1111/j.1365-313X.2009.03870.x
PMid:19392701

Zhang D.S., Liang W.Q., Yuan Z., Li N., Shi J., Wang J., Liu Y.M., Yu W.J., and Zhang D.B., 2008, Tapetum degeneration retardation is critical for aliphatic metabolism and gene regulation during rice pollen development, Molecular Plant, 1(4): 599-610
https://doi.org/10.1093/mp/ssn028
PMid:19825565

Zhang L.R., Tao J.Y., Wang S.X., Chong K., and Wang T., 2006, The rice OsRad21-4, an orthologue of yeast Rec8 protein, is required for efficient meiosis, Plant Mol Biol., 60(4): 533-554
https://doi.org/10.1007/s11103-005-4922-z
PMid:16525890

Zhang M. H., and Zhou K. Y., 2007, An evolutionarily conserved apoptosis inhibitor: Bax Inhibitor-1, Cancer Research on Prevention and Treatment, 34(7): 534-536

Zhao X., de Palma J., Oane R., Gamuyao R., Luo M., Chaudhury A., Hervé P., Xue Q., and Bennett J.,2008, OsTDL1A binds to the LRR domain of rice receptor kinase MSP1, and is required to limit sporocyte numbers, The Plant J., 54(3): 375-387
https://doi.org/10.1111/j.1365-313X.2008.03426.x
PMid:18248596 PMCid:PMC2408674

Zhu Q.H., Ramm K., Shivakkumar R., Dennis E.S., and Upadhyaya N.M., 2004, The ANTHER INDEHISCENCE1 gene encoding a single MYB domain protein is involved in anther development in rice, Plant Physiol.,135(30: 1514-1525
https://doi.org/10.1104/pp.104.041459
PMid:15247409 PMCid:PMC519067